View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14318_low_17 (Length: 292)
Name: NF14318_low_17
Description: NF14318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14318_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 19 - 278
Target Start/End: Original strand, 49039873 - 49040132
Alignment:
| Q |
19 |
gtgtgttccaaaaagaggacgaaacagggtacacaggtgtgtctctatcgaaggagctaatgaaagtggcaggagaagccttgaaaaataacataactga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49039873 |
gtgtgttccaaaaagaggacgaaacagggtacacaggtgtgtctctatcgaaggagctaatgaaagtggcaggagaagccttgaaaaataacataactga |
49039972 |
T |
 |
| Q |
119 |
gttaggtccattggttttgccattttcggagcaattaatgtttatgatatcgttgtttagaaagaagtcatcaaattatgtaccgaatttcaaattggca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49039973 |
gttaggtccattggttttgccattttcggagcaattaatgtttatgatatcgttgtttagaaagaagtcatcaaactatgtaccgaatttcaaattggct |
49040072 |
T |
 |
| Q |
219 |
tttgagcatttctgcatccatggaggtgggagatcagtgttggatgctatgcagaataat |
278 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49040073 |
tttgagcatttctgcatccatgcaggtgggagatcagtgttggatgctatgcagaataat |
49040132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University