View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14318_low_18 (Length: 285)
Name: NF14318_low_18
Description: NF14318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14318_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 17 - 275
Target Start/End: Complemental strand, 330034 - 329776
Alignment:
| Q |
17 |
atgttcatgtcatgatagacagataaatagatcatatgcatgaagaagatattgtatgtttgctgcttcgaattgtatgtatatttttcactactcgtac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
330034 |
atgttcatgtcatgatagacagataaatagatcatatgcatgaagaagatattgtatgtttgctgcttcgaattgtatatatatttttcaccactcgtac |
329935 |
T |
 |
| Q |
117 |
taacttgtttgcgtttgtatattggtgcagttgtgctgctctctgctgttgctgcctattagatgcctgcttctaagaagactttactctgcactaatag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
329934 |
taacttgtttgcgtttgtatattggtgcagttgtgctgctctctgctgttgctgcctattagatgcctgcttctaagaagactttactctgcactaatag |
329835 |
T |
 |
| Q |
217 |
gattgaagtgtgtttaagcattgagctcaatgaaaattgtttcatgtttcttttctgtg |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
329834 |
gattgaagtgtgtttaagcattgagctcaatgaaaattgtttcatgtttcttttctgtg |
329776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 130 - 210
Target Start/End: Original strand, 48030582 - 48030662
Alignment:
| Q |
130 |
tttgtatattggtgcagttgtgctgctctctgctgttgctgcctattagatgcctgcttctaagaagactttactctgcac |
210 |
Q |
| |
|
|||||| |||| ||||| | |||||||||||||||||||| || || ||||| ||||| | ||||||| ||||| ||||| |
|
|
| T |
48030582 |
tttgtaaattgttgcagcttggctgctctctgctgttgctgtctcttggatgcatgcttttgagaagacattactttgcac |
48030662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University