View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14318_low_22 (Length: 248)
Name: NF14318_low_22
Description: NF14318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14318_low_22 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 6 - 248
Target Start/End: Original strand, 32998520 - 32998762
Alignment:
| Q |
6 |
gaaaatgaattagcatgtgctacaaattgttctaactgcaaaatgttcccaaacacattcgggatttcgcctgaaaaatggtttgcagaaaccacaagag |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32998520 |
gaaaatgaattagcatgtgctacaaattgttctaactgcaaaatgttcccaaacacattcgggatttcgcctgaaaaatggtttgcagaaaccacaagag |
32998619 |
T |
 |
| Q |
106 |
attttaggctagtaagcttacttaactccttgcttaacttgccagaaaaattgttggcagagagtgataatctctccaatgataacattgaatacaatga |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32998620 |
attttaggctagtaagcttacttaactccttgcttaacttgccagaaaaattgttggcagagagtgataatctctccaatgataacattgaatacaatga |
32998719 |
T |
 |
| Q |
206 |
ctcaggaaaagggccagaaaatgaattggaatctaaatgtaac |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32998720 |
ctcaggaaaagggccagaaaatgaattggaatctaaatgtaac |
32998762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University