View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14318_low_24 (Length: 243)
Name: NF14318_low_24
Description: NF14318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14318_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 19 - 237
Target Start/End: Complemental strand, 33885335 - 33885117
Alignment:
| Q |
19 |
ctctcatacaaactttctgaaacaccatcatcttcatcattcatcaccatcttcttctgtatctcccatttagagcaacaacaagaagaggccaccccat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33885335 |
ctctcatacaaactttctgaaacaccatcatcttcatcattcatcaccatcttcttctgtctctcccatttagagcaacaacaagaagaggccaccccat |
33885236 |
T |
 |
| Q |
119 |
caatgcgttcatcaaggtatctatagataacacataaaacagcatcaagaagatcaaagatgaggaaaacattgtaacatattattgagttgaacactct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33885235 |
caatgcgttcatcaaggtatctatagataacacataaaacagcatcaagaagatcaaagatgaggaaaacaatgtaacatattattgagttgaacactct |
33885136 |
T |
 |
| Q |
219 |
aatacaattgttaatccat |
237 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33885135 |
aatacaattgttaatccat |
33885117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University