View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14318_low_27 (Length: 235)
Name: NF14318_low_27
Description: NF14318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14318_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 46975 - 46750
Alignment:
| Q |
1 |
tgttgggggtgccaaaaaagaatgtaatatatcatttcagaaaggatctgtgagtagtcaatagttccactagttgggatcttttaaatgtagcgtgggg |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46975 |
tgttgggggtgtcaaaaaagaatgtaatatatcatttcagaaaggatctgcaagtaatcaatagttccaccagttgggatcttttaaatgtagcgtgggg |
46876 |
T |
 |
| Q |
101 |
gagccggttcaagtcttcccagggacannnnnnngnnnnnnntatatataatatacagaagaaaaattaaaagcaagaagcgatatgacttgaacctgcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
46875 |
gagccggttcaagtcttcccagggacatttttttgacaaaaatatatataatatacagaagaaaaattaaaagcaagaagcgatatgacttgaaccagcg |
46776 |
T |
 |
| Q |
201 |
ccttgcttatatatgcctagtataat |
226 |
Q |
| |
|
||||||||||||||||||| |||||| |
|
|
| T |
46775 |
ccttgcttatatatgcctaatataat |
46750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 62 - 119
Target Start/End: Original strand, 24915755 - 24915812
Alignment:
| Q |
62 |
tagttccactagttgggatcttttaaatgtagcgtgggggagccggttcaagtcttcc |
119 |
Q |
| |
|
|||||||| | |||||| || || ||||||||||||||||||||||||||| |||||| |
|
|
| T |
24915755 |
tagttccagtggttgggttccttaaaatgtagcgtgggggagccggttcaattcttcc |
24915812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 143 - 204
Target Start/End: Original strand, 24915833 - 24915894
Alignment:
| Q |
143 |
tatatataatatacagaagaaaaattaaaagcaagaagcgatatgacttgaacctgcgcctt |
204 |
Q |
| |
|
||||||||| |||||| |||||||||||||| | || || ||||||| ||||||||||||| |
|
|
| T |
24915833 |
tatatataaaatacagtagaaaaattaaaagtaggaggcagtatgactcgaacctgcgcctt |
24915894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University