View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14319_high_5 (Length: 264)
Name: NF14319_high_5
Description: NF14319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14319_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 10 - 248
Target Start/End: Original strand, 54267930 - 54268167
Alignment:
| Q |
10 |
gacatcatcataacggaaggtgggaggcacggattggcaaagtttttggcaataagtatctttatctcggaacatatggtaagttcaaaatctttgtctc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54267930 |
gacatcatcataacggaaggtgggaggcacggattggcaaagtttttggcaataagtatctttatctcggaacatatggtaagttcaaaatctttgtctc |
54268029 |
T |
 |
| Q |
110 |
taattatcttggcaaacaatgaaatactgtacacaccttttctttcacaaaataaaatacgtacgtacatatgaacactagataatgtacgtataaatgc |
209 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
54268030 |
taattatcttagcaaacaatgaaatactgtacacaccttttctttcacaaaataaaatacgtacgtacatatgaacactag-tgatgtacgtataaatgc |
54268128 |
T |
 |
| Q |
210 |
tcgtatggtgcgtaaaatgttctttactactataattat |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54268129 |
tcgtatggtgcgtaaaatgttctttactactataattat |
54268167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 25051874 - 25051958
Alignment:
| Q |
10 |
gacatcatcataacggaaggtgggaggcacggattggcaaagtttttggcaataagtatctttatctcggaacatatggtaagtt |
94 |
Q |
| |
|
|||| ||||||||||||||||||||||| || || || | ||||||||||| || ||||||||||| |||||||||||| |||| |
|
|
| T |
25051874 |
gacaccatcataacggaaggtgggaggctcgtatcggtagggtttttggcaacaaatatctttatcttggaacatatggttagtt |
25051958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University