View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14319_low_2 (Length: 415)
Name: NF14319_low_2
Description: NF14319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14319_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 67 - 396
Target Start/End: Original strand, 8467380 - 8467709
Alignment:
| Q |
67 |
ctagtatgcttgtgtgcagtgtcagagcttaatttgtgaaaatagcttgttctattttattaataattcatttattatttcatacaatcaccattgtatg |
166 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8467380 |
ctagtatggttgtgtgcagtgtcagagcttaatttgtgaaaatagcttgttctattttattaataattcatttattatttcatacaatcaccattgtatg |
8467479 |
T |
 |
| Q |
167 |
catataatccatcttgtttgatgaaaaccctagctagcagctggtttatgttttcctactttcccatgcctttattttctagtaatttattcttggatga |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8467480 |
catataatccatcttgtttgatgaaaaccctagctagcagctggtttatgttttcctactttcccatgcctttattttctagtaatttattcttggatga |
8467579 |
T |
 |
| Q |
267 |
ggctaggtttacattagaagaggctcatattatatctatggtgatcagatcagcgaggttgggggaaattagttttctatttttctttactttaccaaac |
366 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8467580 |
ggctaggtttacattagaagaggctcatcttatatctatggtgatcagatcagcgaggttgggggaaattagttttctatttttctttactttaccaaac |
8467679 |
T |
 |
| Q |
367 |
aaattattaagtcaagttttttgtttccta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
8467680 |
aaattattaagtcaagttttttgtttccta |
8467709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University