View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14319_low_7 (Length: 204)
Name: NF14319_low_7
Description: NF14319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14319_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 8467330 - 8467151
Alignment:
| Q |
1 |
agggagaaaacgaaactgtgatttagggcagaaagctggttgtgcttgatagctctcgtggtagttagagttaggcacaagctcatcagataagaaaata |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8467330 |
agggagaaaacgaaactgtgattcagggcagaaagctggttgtgcttgatagctctcgtggtagttagagttaggcacaagttcatcagataagaaaata |
8467231 |
T |
|
| Q |
101 |
gtatatcaggaaggctttacaaagagaagctaacagtggtctgttggcagtatgcccacctcctacagcaaagctacagt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8467230 |
gtatatcaggaaggctttacaaagagaagctaacagtggtctgttggcagtatgcccacctcctacagcaaagctacagt |
8467151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University