View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1431_high_21 (Length: 225)
Name: NF1431_high_21
Description: NF1431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1431_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 31 - 175
Target Start/End: Complemental strand, 7801917 - 7801773
Alignment:
| Q |
31 |
aattcttgcaaatccatatcttcaannnnnnncattaagtggtgatgatgatgtgccttctttctgtcattccatgtgtgctagccttttcatagtagct |
130 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7801917 |
aattcttgcaaatccatatcttcaatttttttcaataagtggtgatgatgatgtgccttctttctgtcattccatgtgtgctagccttttcatagtagct |
7801818 |
T |
 |
| Q |
131 |
atggtgttaattataatcacaatgcaacctcaatctgggctgcag |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7801817 |
atggtgttaattataatcacaatgcaacctcaatctgggctgcag |
7801773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University