View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1431_low_17 (Length: 299)
Name: NF1431_low_17
Description: NF1431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1431_low_17 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 258 - 299
Target Start/End: Original strand, 12570133 - 12570174
Alignment:
| Q |
258 |
gaacttggaatgaagcttccactcttagaggagcttaacatt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12570133 |
gaacttggaatgaagcttccactcttagaggagcttaacatt |
12570174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 258 - 299
Target Start/End: Original strand, 13546597 - 13546638
Alignment:
| Q |
258 |
gaacttggaatgaagcttccactcttagaggagcttaacatt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13546597 |
gaacttggaatgaagcttccactcttagaggagcttaacatt |
13546638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University