View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1431_low_25 (Length: 246)
Name: NF1431_low_25
Description: NF1431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1431_low_25 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 10 - 246
Target Start/End: Complemental strand, 30413577 - 30413341
Alignment:
| Q |
10 |
aatatgcaactctaacccacactttttgtcaaaaaagagcaacacttatcactttcatatttatatgaaccaatcttttatttcaatgctaccaaataat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30413577 |
aatatgcaactctaacccacactttttgtcaaaaaagagcaacacttatcactttcatatttatatgaaccaatcttttatttcaatgctaccaaataat |
30413478 |
T |
|
| Q |
110 |
aatttagctactttnnnnnnnnttgatgcaacctactttgccacctcaagttcttccaattttgagtagaaaaaataacgaacaaatcctttctcccatt |
209 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30413477 |
aattaagctactttaaaaaaaattgatgcaacctactttgccaccttaagttcttccaattttgagtagaaaaaataacgaacaaatcctttctcccatt |
30413378 |
T |
|
| Q |
210 |
aaaccttcttagatacttccattgaagttgctattat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30413377 |
aaaccttcttagatacttccattgaagttgctattat |
30413341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University