View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1431_low_32 (Length: 201)
Name: NF1431_low_32
Description: NF1431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1431_low_32 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 15 - 189
Target Start/End: Original strand, 333516 - 333690
Alignment:
| Q |
15 |
ctgtgttcgagtaaacatgacggacactactgatgacattgccgaggaaatgtccttccaaggcttcgacgatgactgtaagttgcttggaaatcttctc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
333516 |
ctgtgttcgagtaaacatgacggacactactgatgacattgccgaggaaatgtccttccaaggcttcgacgatgactgtaagttgcttggaaatcttctc |
333615 |
T |
 |
| Q |
115 |
aaagatgttttacaaagggaagttggcatcgactttgttgaaaaacttgcaaaaattcgaatccttgcacaggtt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
333616 |
aaagatgttttacaaagggaagttggcatcgactttgttgaaaaacttgcaaaaattcgaatccttgcacaggtt |
333690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 42168930 - 42169015
Alignment:
| Q |
31 |
atgacggacactactgatgacattgccgaggaaatgtccttccaaggcttcgacgatgactgtaagttgcttggaaatcttctcaa |
116 |
Q |
| |
|
||||| |||||||| ||||| ||||| || ||||| || ||||| |||| || ||||| |||| ||||||||| ||||||||||| |
|
|
| T |
42168930 |
atgacagacactacagatgatattgctgaagaaatctcgttccagagctttgatgatgattgtaggttgcttggtaatcttctcaa |
42169015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University