View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14320_high_14 (Length: 235)
Name: NF14320_high_14
Description: NF14320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14320_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 2 - 221
Target Start/End: Original strand, 17394118 - 17394337
Alignment:
| Q |
2 |
taatgttagaatttaatatctataaccatatttttgctgtcgagtttgagactttctgaaactttgagtttgttgatatcaatgacaactgttttggacc |
101 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17394118 |
taatgttagaatttaatatctataacaatatttttgctgtcgagtttgagactttctgaaactttgagtttgttgatatcaatgataactgttttggacc |
17394217 |
T |
 |
| Q |
102 |
gggtcgcagtccgtaacattggcctatcaactcaatatttgtcggtcaaggcaacatagaagacctccggtgtgcctaaccgcacagaagtacaccatgt |
201 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17394218 |
gggtcgcagtccgtaacgttggcctattaactcaatatttgtcgatcaaggcaatatagaagacctccggtgtgcctaaccgcacagaagtacaccatgt |
17394317 |
T |
 |
| Q |
202 |
ttgatctggaccgttgagct |
221 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
17394318 |
ttgatctggaccgttgagct |
17394337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University