View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14323_high_10 (Length: 484)
Name: NF14323_high_10
Description: NF14323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14323_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 168 - 382
Target Start/End: Original strand, 35206689 - 35206903
Alignment:
| Q |
168 |
tacattcgatcaaaatacaaaaagtaaaattttcttctaagtcataatatattgtaattcatctctatcttaggatatcaacaagacatcataaaataaa |
267 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35206689 |
tacattcgatcaaaatacaaaaggtaaaattttcttctaagtcataatatattgtaattcatctctatcttaggatatcaacaagacatcataaaataaa |
35206788 |
T |
 |
| Q |
268 |
tttaatatttggttcatcgagagagaactctatcaacattgtcttgcatattttataccatacccttaatattttttaggataaatattcgtgaagtaac |
367 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35206789 |
tttaatatttggttaatcgagagagaactctatcaaccttgtcttgcatattttatatcatacccttaatattttttaggataaatattcgtgaagtaac |
35206888 |
T |
 |
| Q |
368 |
tcttaagtatttgat |
382 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
35206889 |
tcttaagtatttgat |
35206903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 35206560 - 35206590
Alignment:
| Q |
1 |
aataaataaaagttttgaaatttaggacatg |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35206560 |
aataaataaaagttttgaaatttaggacatg |
35206590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University