View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14323_high_37 (Length: 314)
Name: NF14323_high_37
Description: NF14323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14323_high_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 30 - 173
Target Start/End: Complemental strand, 13255543 - 13255393
Alignment:
| Q |
30 |
aggtgtttgtgcaattctgtggaagagaaccaacaccagatgccttgctcagactcaatggcctaattgcagcttagggataga--atcatccacaattt |
127 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13255543 |
aggtgtttgtgcaattccgtgggagagaaccaacaccagatgcattgctcagacacaatggcctaattgcagcttagggatagaggatcatccacaattt |
13255444 |
T |
 |
| Q |
128 |
tagtttgaaagaaat-----gcacaataaattataataatacataattgtg |
173 |
Q |
| |
|
|| ||||||| ||| |||| |||||||||||||||||||||||||| |
|
|
| T |
13255443 |
tattttgaaaaaaaaaaaaagcactataaattataataatacataattgtg |
13255393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 293
Target Start/End: Complemental strand, 13252904 - 13252860
Alignment:
| Q |
249 |
aataaatgaatagttgaggctgactactattcatcatatatgtat |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13252904 |
aataaatgaatagttgaggctgactactattcatcatatatgtat |
13252860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University