View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14323_high_46 (Length: 252)
Name: NF14323_high_46
Description: NF14323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14323_high_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 47180480 - 47180380
Alignment:
| Q |
1 |
cattgtcgctcttaggacgctcgtttctttactaaaatacttcccttttgccttgaacagccactaagataaaattttaacactaataattgattaacat |
100 |
Q |
| |
|
||||||||||||||| |||||| || ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47180480 |
cattgtcgctcttagaacgctcattcctttactaaaatacttcccttttgccttgaacaaccactaagataaaattttaacactaataattgattaacat |
47180381 |
T |
 |
| Q |
101 |
c |
101 |
Q |
| |
|
| |
|
|
| T |
47180380 |
c |
47180380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 158 - 236
Target Start/End: Complemental strand, 47180384 - 47180306
Alignment:
| Q |
158 |
acatcaaccacaaaatgggtaggcatgatccaaatcaatgttagtaaaaacactactaaaaccatgttaaccaaaatgt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47180384 |
acatcaaccacaaaatgggtaggcatgatccaaatcaatgttagtaaaaacactactaaaaccatgttaaccaaaatgt |
47180306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University