View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14323_high_49 (Length: 246)
Name: NF14323_high_49
Description: NF14323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14323_high_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 10 - 230
Target Start/End: Complemental strand, 27202618 - 27202396
Alignment:
| Q |
10 |
gcaaagggactaattagagctaacttgcagttttgtattacttaaataat--tatgatatttttaactctaacagaacatgccaatggtctccctggatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27202618 |
gcaaagggactaattagagctaacttgcagctttgtattactttaataatattatgatatttttaactctaacagaacatgccaatggtctccctggatt |
27202519 |
T |
 |
| Q |
108 |
gaacgagaatcccaaaacagttcaaaaaaggaaagtttttgggtcacctgtaaaggctgtacatattggtctgaagctaggctcaaattctttgttgggt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27202518 |
gaacgagaatcccaaaacagttcaaaaaaggaaagtttttgggtcacctgtaaaggctgtgcatattggtctgaagctaggctcaaattctttgttgggt |
27202419 |
T |
 |
| Q |
208 |
attttaggaaggatggcccttct |
230 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
27202418 |
attttaggaaggatggcccttct |
27202396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 65 - 216
Target Start/End: Complemental strand, 27218380 - 27218229
Alignment:
| Q |
65 |
tatttttaactctaacagaacatgccaatggtctccctggattgaacgagaatcccaaaacagttcaaaaaaggaaagtttttgggtcacctgtaaaggc |
164 |
Q |
| |
|
||||||| | ||||||| |||| || ||||||||||| ||||| || || || ||| | ||| |||||||| ||||||||||| |||||||||| ||| | |
|
|
| T |
27218380 |
tatttttgattctaacaaaacacgctaatggtctccccggattaaatgataaccccgagacaattcaaaaagggaaagttttttggtcacctgtgaagcc |
27218281 |
T |
 |
| Q |
165 |
tgtacatattggtctgaagctaggctcaaattctttgttgggtattttagga |
216 |
Q |
| |
|
|||||| |||||||||||||| | ||||| ||||||||||| |||| |||| |
|
|
| T |
27218280 |
ggtacattttggtctgaagctaagttcaaaatctttgttgggcatttcagga |
27218229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University