View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14323_high_53 (Length: 236)
Name: NF14323_high_53
Description: NF14323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14323_high_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 153
Target Start/End: Complemental strand, 12104280 - 12104128
Alignment:
| Q |
1 |
tacctcatttagtttcactgacaccacttgtactaagtacttaattcttaaaaacaaaaatgaatgcctttcaagaaacaagtaaacataaacaggttgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12104280 |
tacctcatttagtttcactgacaccacttgtactaagtacttaattcttaaaaacaaaaatgaatgcctttcaagaaacaagtaaacctaaacaggttgc |
12104181 |
T |
 |
| Q |
101 |
taattacatttactggtatgaaatgaagttgtcaaatatagtactcattagta |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12104180 |
taattacatttactggtatgaaatgaagttgtcaaatatagtactcattagta |
12104128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 193 - 221
Target Start/End: Complemental strand, 12104111 - 12104083
Alignment:
| Q |
193 |
atctattataaacatattagtgaaaaagt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12104111 |
atctattataaacatattagtgaaaaagt |
12104083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University