View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14323_high_55 (Length: 233)
Name: NF14323_high_55
Description: NF14323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14323_high_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 107 - 216
Target Start/End: Original strand, 6371726 - 6371835
Alignment:
| Q |
107 |
tgtttagatgagtttattacctttgtgattttatttcgttgaagaaataagaaacagttttagagaatgagaaagatagaaagagattaagagacttaag |
206 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6371726 |
tgtttagatgagtttattacctttatgattttgtttcgttgaagaaataagaaacagttttagagaatgagaaagatagaaagagattaagagaattaag |
6371825 |
T |
 |
| Q |
207 |
gaactaaatg |
216 |
Q |
| |
|
|||||||||| |
|
|
| T |
6371826 |
gaactaaatg |
6371835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 13 - 55
Target Start/End: Original strand, 6371687 - 6371729
Alignment:
| Q |
13 |
aatataaacaatgatttataaaagtaaatccgtagattctgtt |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6371687 |
aatataaacaatgatttataaaagtaaatccgtagattctgtt |
6371729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 152 - 200
Target Start/End: Complemental strand, 31540255 - 31540206
Alignment:
| Q |
152 |
aataagaaacagttttagagaatgagaaagatag-aaagagattaagaga |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||| || |||| |||||||||| |
|
|
| T |
31540255 |
aataagaaacagttttagagaataagaaagagagaaaagtgattaagaga |
31540206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 194
Target Start/End: Original strand, 12198035 - 12198076
Alignment:
| Q |
153 |
ataagaaacagttttagagaatgagaaagatagaaagagatt |
194 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
12198035 |
ataagaaacagttttagagaatgaaaaagagagaaagagatt |
12198076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University