View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14323_high_62 (Length: 212)
Name: NF14323_high_62
Description: NF14323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14323_high_62 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 9 - 197
Target Start/End: Original strand, 26137672 - 26137860
Alignment:
| Q |
9 |
ccaagaatattgatgttgtcaattgtgttcgatcttacggacgagacgaacatcatatcttaatttggagtatttggtgttttcaatttcataggttgtt |
108 |
Q |
| |
|
|||| |||||||||||||||||||||| | || ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26137672 |
ccaacaatattgatgttgtcaattgtgctagaccttacggacgagacgaacatcatatcttaatttcgagtatttggtgttttcaatttcataggttgtt |
26137771 |
T |
 |
| Q |
109 |
atattagtaatgtaattttgttaaaaactaatagtaatagtgtgtaattaaaatgaataatccgcgtaaggaaaatgtgaccaactaac |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26137772 |
atattagtaatgtaattttgttaaaaactaacagtaatagtgtgtaattaaaatgaataatccgcgtaaggaaaatgtgaccaactaac |
26137860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University