View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14323_low_21 (Length: 420)
Name: NF14323_low_21
Description: NF14323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14323_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 384; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 384; E-Value: 0
Query Start/End: Original strand, 10 - 401
Target Start/End: Original strand, 23323858 - 23324249
Alignment:
| Q |
10 |
gaagcaaaggaccagcatcaatcacagcttgtaaaagtttacccttttgaggcaaaactttttctttagcaatagaatctatagcaacagttccatgatc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23323858 |
gaagcaaaggaccagcatcaatcacagcttgtaaaagtttacccttttgaggcaaaactttttctttagcaatagaatctatagcaacagttccatgatc |
23323957 |
T |
|
| Q |
110 |
agaaactggcttttcactgggcaccctcaaataattgaagtgttgattttgatgatggttgagataggccatgttggtgtttgaaaactcaggtgaagaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23323958 |
agaaactggcttttcactgggcaccctcaaataattgaagtgttgattttgatgatgattgagataggccatgttggtgtttgaaaactcaggtgaagaa |
23324057 |
T |
|
| Q |
210 |
acagtttcaaagaatgaatcgaccggtggagaaccgtgtgagagactgctagattctgtaatgctagggtttgaagagtgaaacattagaggattttctt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23324058 |
acagtttcaaagaatgaatcgaccggtggagaaccgtgtgagagactgctagattctgtaatgctagggtttgaagagtgaaacattagaggattttctt |
23324157 |
T |
|
| Q |
310 |
gttggaatccagaaatgaacttgtcttggaaatggattggacttaggttgttcattagtttttgcagctgatttttagcttcatctctttct |
401 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23324158 |
gttggaatccagaaatgaacttgtcttggaaatggattggacttgggttgttcattagtttttgcagctgatttttagcttcatctctttct |
23324249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 10 - 65
Target Start/End: Original strand, 21010383 - 21010438
Alignment:
| Q |
10 |
gaagcaaaggaccagcatcaatcacagcttgtaaaagtttacccttttgaggcaaa |
65 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||||||||||| |||| ||||||| |
|
|
| T |
21010383 |
gaagcaaaggaccagctttcatcactgcttgtaaaagtttacctttttcaggcaaa |
21010438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University