View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14323_low_29 (Length: 373)
Name: NF14323_low_29
Description: NF14323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14323_low_29 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 20 - 373
Target Start/End: Complemental strand, 1591065 - 1590714
Alignment:
| Q |
20 |
accctctcataattcctcatccaaaaccagaagaaagnnnnnnnnttcattcattttcaatctcacttctctcttcttctcttgtgctatatacctcttg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1591065 |
accctctcataattcctcatccaaaaccagaagaaa--aaaaaaattcattcattttcaatctcacttctctcttcttctcttgtgctatatatctcttg |
1590968 |
T |
 |
| Q |
120 |
cttaatctttgtctttacnnnnnnnnnnnnnnnnnnntatgtctggggtttgggtgttcaagaatggcgtgtttcgattggtcgagaatcctcaagcaga |
219 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1590967 |
cttaatctttgtctttacaaaaacaaaacaaaaaaaatatgtctggggtttgggtgttcaagaatggcgtgtttcgattggtcgagaatcctcaagcaga |
1590868 |
T |
 |
| Q |
220 |
atcggaagtaaggcatgggaagaggaagatgttggttcacttgcccacaggggaagtggtaacttcttatgcttttcttgagagaatattgattggttta |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1590867 |
atcggaagtaaggcatgggaagaggaagatgttggttcacttgcccacaggggaagtggtaacttcttatgcttttcttgagagaatattgattggttta |
1590768 |
T |
 |
| Q |
320 |
ggttgggagaggtactatgatggagatgttgatttataccaatttcataaacac |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1590767 |
ggttgggagaggtactatgatggagatgttgatttataccaatttcataaacac |
1590714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University