View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14323_low_49 (Length: 252)

Name: NF14323_low_49
Description: NF14323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14323_low_49
NF14323_low_49
[»] chr3 (2 HSPs)
chr3 (1-101)||(47180380-47180480)
chr3 (158-236)||(47180306-47180384)


Alignment Details
Target: chr3 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 47180480 - 47180380
Alignment:
1 cattgtcgctcttaggacgctcgtttctttactaaaatacttcccttttgccttgaacagccactaagataaaattttaacactaataattgattaacat 100  Q
    ||||||||||||||| |||||| || ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
47180480 cattgtcgctcttagaacgctcattcctttactaaaatacttcccttttgccttgaacaaccactaagataaaattttaacactaataattgattaacat 47180381  T
101 c 101  Q
    |    
47180380 c 47180380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 158 - 236
Target Start/End: Complemental strand, 47180384 - 47180306
Alignment:
158 acatcaaccacaaaatgggtaggcatgatccaaatcaatgttagtaaaaacactactaaaaccatgttaaccaaaatgt 236  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47180384 acatcaaccacaaaatgggtaggcatgatccaaatcaatgttagtaaaaacactactaaaaccatgttaaccaaaatgt 47180306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University