View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14323_low_60 (Length: 226)
Name: NF14323_low_60
Description: NF14323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14323_low_60 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 4 - 226
Target Start/End: Original strand, 44035582 - 44035804
Alignment:
| Q |
4 |
cagattgcggtagggatagctagatgactagagtacttgcataaaaggtgcaacactaggattcttcatttcgacattaaatcacataacattcttttgg |
103 |
Q |
| |
|
|||||||| ||||||||||| || |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44035582 |
cagattgcaatagggatagctcgaggactagagtacttgcataaagggtgcaacactaggatttttcatttcgacattaaaccacataacattcttttgg |
44035681 |
T |
 |
| Q |
104 |
acgaaacttaccgtccgaagaaatctgattttggacttgctaaactaagcacaaggaatgagagaaatatttcaacgtcaaatgctagaggtacggttgg |
203 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||||||| | |||||||| |||||| |||||||| || ||||| |
|
|
| T |
44035682 |
acgaaacttaccgtcccaagatatctgattttggacttgctaaactaagcacaagcaatgagagcattatttcaatgtcaaacgctagagggactgttgg |
44035781 |
T |
 |
| Q |
204 |
atatgttgctcctgaagttttca |
226 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
44035782 |
gtatgttgctcctgaagttttca |
44035804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 101
Target Start/End: Complemental strand, 31189708 - 31189636
Alignment:
| Q |
29 |
gactagagtacttgcataaaaggtgcaacactaggattcttcatttcgacattaaatcacataacattctttt |
101 |
Q |
| |
|
|||||||||||||||||| | | || | ||| || ||| | ||||||||||| ||| |||||||||||||||| |
|
|
| T |
31189708 |
gactagagtacttgcatagaggatgtaccacaagaattttacatttcgacataaaaccacataacattctttt |
31189636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University