View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14324_high_8 (Length: 274)
Name: NF14324_high_8
Description: NF14324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14324_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 21 - 235
Target Start/End: Complemental strand, 37201425 - 37201211
Alignment:
| Q |
21 |
ataagaagctacatagtcagttagttgagatttctatctttcagaccaaggttgttaagctgttcagttaacttttaaactctgacgagtttgcaattct |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37201425 |
ataagaagctacatagtcagttagttgagatttctatctttcagaccaaggttgttaagctgttcagttaacttttaaactctgacgagtttgcaattct |
37201326 |
T |
 |
| Q |
121 |
aggtcgtgaaaacaagttaacctgcttgtaaactctcttgttataaactcttatgagatcaagtaaaacccgataaaattaattaactctcgattttaca |
220 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37201325 |
aggtcgtgaaaacaaattaacctgcttgtaaactctcttgttataaactcttatgagatcaagtaaaacccgataaaattaattaactctcgattttaca |
37201226 |
T |
 |
| Q |
221 |
actagtttagctgta |
235 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
37201225 |
actagtttagttgta |
37201211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 234 - 262
Target Start/End: Complemental strand, 37200342 - 37200314
Alignment:
| Q |
234 |
tacctgtgttcaagttatctgttaatctg |
262 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37200342 |
tacctgtgttcaagttatctgttaatctg |
37200314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University