View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14324_low_10 (Length: 264)
Name: NF14324_low_10
Description: NF14324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14324_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 17 - 116
Target Start/End: Original strand, 25330068 - 25330167
Alignment:
| Q |
17 |
acataggggtcatgagtgagagacacgacactgggattatcatacagtaacttaagtgtattaatgggaactttgagtaaagatttcagcctcgatgctt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
25330068 |
acataggggtcatgagtgagagacacgacactggaattatcacacagtaacttaagtatattaatgagaactttgagtaaagatttcaccctcgatgctt |
25330167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 109 - 165
Target Start/End: Original strand, 25330191 - 25330247
Alignment:
| Q |
109 |
cgatgctttgagcatgaacgtttctacttaaacattcactctgtttcgaaatacatt |
165 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25330191 |
cgattctttgatcatgaacgtttctacttaaacattcactctgtttcaaaatacatt |
25330247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University