View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14325_high_9 (Length: 317)
Name: NF14325_high_9
Description: NF14325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14325_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 39 - 301
Target Start/End: Complemental strand, 26368869 - 26368608
Alignment:
| Q |
39 |
ataatatagttttgatgaaggaaattttgtacaaatactatactatctaattattgaaacaaaatttccatttccaattgagtattttcatttatcttca |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26368869 |
ataatatagttttgatgaaggaaattttgtacaaatactatactatctaattattgaaacaaaatttccatttccaattgagtattttcatttatcttca |
26368770 |
T |
 |
| Q |
139 |
ctcttgtttctaaattttcggttaaattcatttttcactcaatttagtgccaatgtaatctaatttagatttgtcattaaatcgatctaatttaattcta |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26368769 |
ctcttgtttctaaattttcggttaaattcatttttcactcaatttagtgtcaatgtaatctaatttagatttttcattaaatcgatctaatttaattcta |
26368670 |
T |
 |
| Q |
239 |
taaatctgaccccttctttttatcttttgtactccttttagggatagtttgttgcaaatttga |
301 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26368669 |
taaatc-gaccccttctttttatcttttgtactccttttagggatagtttgttgcaaatttga |
26368608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University