View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14325_low_7 (Length: 335)
Name: NF14325_low_7
Description: NF14325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14325_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 245
Target Start/End: Complemental strand, 30888324 - 30888097
Alignment:
| Q |
18 |
ctattgtctggcaatgaagttgtaaaggtagatttttgttcagttgattaattgaagatcaaaagaagaatggcaacccaaatttcttgagaatgaaatc |
117 |
Q |
| |
|
||||||||||||||||||||||| || || ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30888324 |
ctattgtctggcaatgaagttgttaaagtggatttttgttcagttgattaattgacgatcaaaagaagaatggcaacccaaatttcttgagaatgaaatc |
30888225 |
T |
|
| Q |
118 |
attgaaaatttctgtgactaagatcaagccacgaatgttttactatttttgaacacaaaggtggtagagattagcactatattaggagcataacatggct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30888224 |
attgaaaatttctgtgactaagatcaagccacgaatgttttactatttttgaacacaaaggtggtagagattagcactatattaggagcataacatggct |
30888125 |
T |
|
| Q |
218 |
tgccacgatcgatcagttaaacctccaa |
245 |
Q |
| |
|
|||||||||| ||||||||||||||||| |
|
|
| T |
30888124 |
tgccacgatctatcagttaaacctccaa |
30888097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University