View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14326_high_3 (Length: 351)
Name: NF14326_high_3
Description: NF14326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14326_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 290
Target Start/End: Original strand, 33144557 - 33144824
Alignment:
| Q |
18 |
caaaatgccatctatggaaaacacaattagcgatttggaggaagagactagagaacatgaaaaaatttcattagacttcaaagcagaactggatcgtgtc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33144557 |
caaaatgccatctatggaaaacacaattcgcgatttggaggaagagactagagaacatgaaaaaatttcattagacttcaaagcagaacttgatcgtgtc |
33144656 |
T |
 |
| Q |
118 |
aaagaatcacttgttaaacccaacaatatcaacatactccatctttggaaaacacagttagctcattcgagaaattagccagaaaacatataaaattgtt |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||| | |||||||| ||||||||||||||||||| ||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
33144657 |
aaagaatcacttgtcaaacccaacaatac-----tcctccatctgtggaaaacacagttagctccttcgagaaattagcccgaaaacatagaaaattgtt |
33144751 |
T |
 |
| Q |
218 |
aataaaattgacaccgaaagtggacggtttaacagaaaggcttgttaaactcaaaaacatcaacaaggagcag |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33144752 |
aataaaattgacaccgaaagtggacggtttaacagaaaggcttgttaaactcaaaaacatcaacaaggagcag |
33144824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University