View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14327_high_17 (Length: 303)
Name: NF14327_high_17
Description: NF14327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14327_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 37 - 287
Target Start/End: Complemental strand, 28093949 - 28093699
Alignment:
| Q |
37 |
ttatattttgaatccccttcacatttgctccggttgaatgcgtatctatgatgaaatgtgacaaaagtgctttaaccaaatagacttgatggatgttggg |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28093949 |
ttatattttgaatccccttcacatttgctccggttgaatgcgtatctatgatgaaatgtgacaaaagtgctttaaccaaatagacttgatggatgttggg |
28093850 |
T |
|
| Q |
137 |
ggcagagtctatgaaccattggtgcaaacacgaatactgaacgcgacattgaccaagacacttcggcacccatagcatttggaaaaatgaattaattgaa |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28093849 |
ggcagagtctatgaaccattggtgcaaacacgaatactgaacgtgacattgaccaagacacttcggcacccatagcatttggaaaaatgaattaattgaa |
28093750 |
T |
|
| Q |
237 |
tgtaatccccttccgggaccctgtgtacgcgggagctttactgcacaggtt |
287 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
28093749 |
tgtaatcctcttccaagaccctgtgtacgcgggagctttactgcaccggtt |
28093699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 213 - 242
Target Start/End: Original strand, 41330312 - 41330341
Alignment:
| Q |
213 |
atttggaaaaatgaattaattgaatgtaat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41330312 |
atttggaaaaatgaattaattgaatgtaat |
41330341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University