View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14327_low_19 (Length: 303)

Name: NF14327_low_19
Description: NF14327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14327_low_19
NF14327_low_19
[»] chr4 (1 HSPs)
chr4 (37-287)||(28093699-28093949)
[»] chr3 (1 HSPs)
chr3 (213-242)||(41330312-41330341)


Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 37 - 287
Target Start/End: Complemental strand, 28093949 - 28093699
Alignment:
37 ttatattttgaatccccttcacatttgctccggttgaatgcgtatctatgatgaaatgtgacaaaagtgctttaaccaaatagacttgatggatgttggg 136  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28093949 ttatattttgaatccccttcacatttgctccggttgaatgcgtatctatgatgaaatgtgacaaaagtgctttaaccaaatagacttgatggatgttggg 28093850  T
137 ggcagagtctatgaaccattggtgcaaacacgaatactgaacgcgacattgaccaagacacttcggcacccatagcatttggaaaaatgaattaattgaa 236  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28093849 ggcagagtctatgaaccattggtgcaaacacgaatactgaacgtgacattgaccaagacacttcggcacccatagcatttggaaaaatgaattaattgaa 28093750  T
237 tgtaatccccttccgggaccctgtgtacgcgggagctttactgcacaggtt 287  Q
    |||||||| |||||  |||||||||||||||||||||||||||||| ||||    
28093749 tgtaatcctcttccaagaccctgtgtacgcgggagctttactgcaccggtt 28093699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 213 - 242
Target Start/End: Original strand, 41330312 - 41330341
Alignment:
213 atttggaaaaatgaattaattgaatgtaat 242  Q
    ||||||||||||||||||||||||||||||    
41330312 atttggaaaaatgaattaattgaatgtaat 41330341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University