View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14327_low_25 (Length: 238)

Name: NF14327_low_25
Description: NF14327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14327_low_25
NF14327_low_25
[»] chr7 (1 HSPs)
chr7 (81-219)||(2673467-2673605)


Alignment Details
Target: chr7 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 81 - 219
Target Start/End: Original strand, 2673467 - 2673605
Alignment:
81 tgattcagttattaatcnnnnnnngaatgcaatttcgatgaaattgaagaaggaagaaagaaaatcaatcatgagaattgagttttgtggatatttgaga 180  Q
    |||||||||||||||||       |||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||    
2673467 tgattcagttattaatcaagaaaagaatgcaatttcgatgaaattgaagacggaagaaagaaaatcaattatgagaattgagttttgtggatatttgaga 2673566  T
181 aaaaatgcagcaacaatggcaggaccccattacagggca 219  Q
    |||||||||||||||||||||||||||||||||||||||    
2673567 aaaaatgcagcaacaatggcaggaccccattacagggca 2673605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University