View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14327_low_25 (Length: 238)
Name: NF14327_low_25
Description: NF14327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14327_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 81 - 219
Target Start/End: Original strand, 2673467 - 2673605
Alignment:
| Q |
81 |
tgattcagttattaatcnnnnnnngaatgcaatttcgatgaaattgaagaaggaagaaagaaaatcaatcatgagaattgagttttgtggatatttgaga |
180 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2673467 |
tgattcagttattaatcaagaaaagaatgcaatttcgatgaaattgaagacggaagaaagaaaatcaattatgagaattgagttttgtggatatttgaga |
2673566 |
T |
 |
| Q |
181 |
aaaaatgcagcaacaatggcaggaccccattacagggca |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2673567 |
aaaaatgcagcaacaatggcaggaccccattacagggca |
2673605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University