View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14328_high_14 (Length: 330)
Name: NF14328_high_14
Description: NF14328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14328_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 262
Target Start/End: Complemental strand, 8437894 - 8437644
Alignment:
| Q |
18 |
atgaatgatactgttatttttgcaaggatgaatggtgatgagaatgatagttgtatgcagtttttgagggacatggaagttgttcaggttcctacttttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8437894 |
atgaatgatactgttatttttgcaaggatgaatggtgatgagaatgatagttgtatgcagtttttgagggacatggaagttgttcaggttcctacttttt |
8437795 |
T |
|
| Q |
118 |
tgttcattagagatggtaagattgctggtaggtatgttggttcagggaaaggtgaactcattggtgaaattctcaggtaccaaggagttcgtgttactta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8437794 |
tgttcattagagatggtaagattgctggtaggtatgttggttcagggaaaggtgaactcattggtgaaattctcaggtaccaaggagttcgtgttactta |
8437695 |
T |
|
| Q |
218 |
tt------aaatcaaatcaattgcttgttcatgtttgtattgatcataaac |
262 |
Q |
| |
|
|| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8437694 |
ttaaaatcaaatcaaatcaattgcttgttcatgtgtgtattgatcataaac |
8437644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 283 - 312
Target Start/End: Complemental strand, 8437623 - 8437594
Alignment:
| Q |
283 |
gttaaggatttgtctcactgatttcatttt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
8437623 |
gttaaggatttgtctcactgatttcatttt |
8437594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University