View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14328_high_16 (Length: 324)
Name: NF14328_high_16
Description: NF14328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14328_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 19 - 312
Target Start/End: Complemental strand, 10760401 - 10760108
Alignment:
| Q |
19 |
aattaaaacatgatcaggaagcataactgtttcccgaattgtgatttggggtggcactggagttggccatttcaaagctgcaattgggatgtgaaatcga |
118 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760401 |
aattaaaacatgatcaggaagcaaaactgtttcccgaattgtgatttggggtggcactggagttggccatttcaaagctgcaattgggatgtgaaatcga |
10760302 |
T |
 |
| Q |
119 |
gggaggtagaaggggtggatggatgaaataattagggaggtaaagataatggaagataagacaaccacaatagtgaaccagaagaatgtgctccatgaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10760301 |
gggaggtagaaggggtggatggatgaaataattagggaggtaaagataatggaagataagacaaccacaatagtgaaccaaaagaatgtgctccatgaaa |
10760202 |
T |
 |
| Q |
219 |
tggctctgctatgttttctatgatctttcatgagagaaacccaaaacgagaagaaaaatgtaatagtaatgttctttgggttgcttcatctcac |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10760201 |
tggctctgctatgttttctatgatctttcatgagagaaacccaaaacgagaagaaaaatgtaatagtaatgttctttgggttgcttcatgtcac |
10760108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University