View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14328_high_24 (Length: 236)
Name: NF14328_high_24
Description: NF14328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14328_high_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 222
Target Start/End: Original strand, 26756402 - 26756605
Alignment:
| Q |
19 |
ttgtctttaatgacaaattatataccaatgaaagaatctatagaaagtgaaaaatgaaaaatatgacagtatccagcttttgttactcggattctggttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26756402 |
ttgtctttaatgacaaattatataccaatgaaagaatctatagaaagtgaaaaatgaaaaatatgacagtatccagcttttgttactcagattctggttc |
26756501 |
T |
 |
| Q |
119 |
acgtatatttgcagctagaaaatataaaccgtagagatcgataaataacaagccttttttccaaaagtcaatattattcatgacaagaagcttgatgtga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26756502 |
acgtatatttgcagctagaaaatataaaccgtagagatcgataaataacaagccttttttccaaaagtcaatattattcatgacaagaagcttgatgtga |
26756601 |
T |
 |
| Q |
219 |
tgat |
222 |
Q |
| |
|
|||| |
|
|
| T |
26756602 |
tgat |
26756605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University