View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14328_high_27 (Length: 225)
Name: NF14328_high_27
Description: NF14328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14328_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 148
Target Start/End: Original strand, 11590944 - 11591091
Alignment:
| Q |
1 |
attcagttttttcagtttattattaagcttcattatctttgctctaacagcatcatcatgctctttcctttgtgtttgagattcggttccttctgcagca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11590944 |
attcagttttttcagtttattattaagcttcattatctttgctctaacagcatcatcatgctctttcctttgtgtttgagattcggttccttctgcagca |
11591043 |
T |
 |
| Q |
101 |
acagtggtagttgtagatgnnnnnnnaggatcaggtgaattttgatgc |
148 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11591044 |
acagtggtagttgtagatgtttttttaggatcaggtgaattttgatgc |
11591091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 11646723 - 11646576
Alignment:
| Q |
1 |
attcagttttttcagtttattattaagcttcattatctttgctctaacagcatcatcatgctctttcctttgtgtttgagattcggttccttctgcagca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11646723 |
attcagttttttcagtttattattaagcttcattatctttgctctaacagcatcatcatgctctttcctttgtgtttgagattcggttccttctgcagca |
11646624 |
T |
 |
| Q |
101 |
acagtggtagttgtagatgnnnnnnnaggatcaggtgaattttgatgc |
148 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11646623 |
acagtggtagttgtagatgtttttttaggatcaggtgaattttgatgc |
11646576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University