View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14328_high_28 (Length: 213)
Name: NF14328_high_28
Description: NF14328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14328_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 59 - 203
Target Start/End: Original strand, 1696684 - 1696824
Alignment:
| Q |
59 |
aacacaaacctgcttgaaactgttaatttttggccttataagcattttcttacacaaa--tgcatgatattgatatgcatgctcatcaataagggtattg |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
1696684 |
aacacaaacctgcttgaaactgttaatttttggccttataagcattttcttacacaaacctgcatgat------atgcatgctcatcaataagggtattg |
1696777 |
T |
 |
| Q |
157 |
atgaaatgtacttagtaaatagttgatatgcatgcagaataatctac |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1696778 |
atgaaatgtacttagtaaatagttgatatgcatgcagaataatctac |
1696824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 48
Target Start/End: Original strand, 1696637 - 1696666
Alignment:
| Q |
19 |
acatgaccactgatctgcttgaaaaatgag |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1696637 |
acatgaccactgatctgcttgaaaaatgag |
1696666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University