View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14328_high_30 (Length: 210)

Name: NF14328_high_30
Description: NF14328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14328_high_30
NF14328_high_30
[»] chr4 (1 HSPs)
chr4 (112-197)||(11646368-11646453)


Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 112 - 197
Target Start/End: Complemental strand, 11646453 - 11646368
Alignment:
112 tgcaagttattcaacttaacttgttatttaaggaactcaaaaaagagacgatgtttattcaaattcagtgcataccacagagactt 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||    
11646453 tgcaagttattcaacttaacttgttatttaaggaactcaaaaaagagactatgtttattcaaattcagtgcatactacagagactt 11646368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University