View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14328_low_12 (Length: 399)
Name: NF14328_low_12
Description: NF14328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14328_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 380; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 380; E-Value: 0
Query Start/End: Original strand, 1 - 392
Target Start/End: Complemental strand, 41744235 - 41743844
Alignment:
| Q |
1 |
cgtttcctcaactccggcggcttctcaaaaagctccctaaccccaggcaatttcttcgctgcaccgaaatatctataccccggcccccttccactagggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41744235 |
cgtttcctcaactccggcggcttctcaaaaagctccctaaccccaggcaatttcttcgctgcaccgaaatatctatacccgggcccccttccactagggt |
41744136 |
T |
 |
| Q |
101 |
tagggacatcaacaatattcccatccaaatcagtcattttcgcagaatgcctagcgtaattcggtcctccaagctcaacaattctcctctcccaatgcga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41744135 |
tagggacatcaacaatattcccatccaaatcagtcattttcgcagaatgcctcgcgtaattcggtcctccaagctcaacaattctcctctcccaatgcga |
41744036 |
T |
 |
| Q |
201 |
tttctcacgaatgagtttgttaatttcgtcgttgagatcacgaagacggtgttcgccgagaccttcgttttgaatctcggcgactttgcggccgatttcg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41744035 |
tttctcacgaatgagtttgttaatttcgtcgttgagatcacgaagacggtgttcgccgagaccttcgttttgaatctcggcgactttgcggccgatttcg |
41743936 |
T |
 |
| Q |
301 |
cgcatgatttgctgacgccatttgtcggcttcgtttaggtcacgacattcagaagcgagaaaaggacggcgttcttttggtttcttcatttc |
392 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41743935 |
cgcatgatttgctgacgccatttgtcggcttcgtttaggtcacgacattcagaagcgagaaaaggacggcgttcttttggtttcttcttttc |
41743844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University