View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14328_low_26 (Length: 231)
Name: NF14328_low_26
Description: NF14328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14328_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 214
Target Start/End: Original strand, 41744236 - 41744434
Alignment:
| Q |
16 |
aaggacgagatatgatatttataagaggattaatgctgcttattatggttatagggatgatgaagatgggatattggagcgggttgaggctccggctgag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41744236 |
aaggacgagatatgatatttataagaggattaatgctgcttattatggttatagggatgatgaagatgggatattggagcgagttgaggctccggctgag |
41744335 |
T |
|
| Q |
116 |
gaatgtatgagacgcgaggcggttgaggagtgggagaggttggataggataaggaaggaagctaggaaggctgtgaggagtggggaggttgctgaggtt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41744336 |
gaatgtatgagacgcgaggcggttgaggagtgggagaggttggataggataaggaaggaagctaggaaggctgtgaggagtggggaggttgttgaggtt |
41744434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University