View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14328_low_30 (Length: 210)
Name: NF14328_low_30
Description: NF14328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14328_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 112 - 197
Target Start/End: Complemental strand, 11646453 - 11646368
Alignment:
| Q |
112 |
tgcaagttattcaacttaacttgttatttaaggaactcaaaaaagagacgatgtttattcaaattcagtgcataccacagagactt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11646453 |
tgcaagttattcaacttaacttgttatttaaggaactcaaaaaagagactatgtttattcaaattcagtgcatactacagagactt |
11646368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University