View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14328_low_32 (Length: 207)
Name: NF14328_low_32
Description: NF14328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14328_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 192
Target Start/End: Original strand, 40186534 - 40186708
Alignment:
| Q |
17 |
acactttgcattgtactttcctgaagcatctcactataaaagtgtgaaagagccacgccatcactaatcatctttttatccttttcaaaccatgatgaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40186534 |
acactttgcattgtactttcctgaagcatctcactataaaagtgtgaaagagccaggccatcactaatcatctttttatccttttcaaaccatgatgaaa |
40186633 |
T |
 |
| Q |
117 |
ttgccaaatgaggtaaaaaccctttttccttcattgtctgtaaagtaatccaaatttgctctttcatatatctgtg |
192 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40186634 |
ttgccaaatgaggt-aaaaccctttttccttcattgtctgtaaagtaatccaaatttgctctttcatatagctgtg |
40186708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University