View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14329_high_14 (Length: 206)
Name: NF14329_high_14
Description: NF14329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14329_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 4e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 13 - 192
Target Start/End: Original strand, 46207395 - 46207574
Alignment:
| Q |
13 |
gaaatgaaactggggtggttgccaatgacggcgacagtgatgacggagatgagatggatgtagataacagtgcttctaagttttctaaaggttggatatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46207395 |
gaaatgaaactggggtggttgccaatgacggcgacagtgacgacggagatgagatggatgtagataacagtgcttctaagttttctaaaggttggatatg |
46207494 |
T |
 |
| Q |
113 |
attggcacagatactatatcttattataagttcattttacaannnnnnnatatgttaagaaaaacaagcattgaatataa |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
46207495 |
attggcacagatactatatcttattataagttcattttacaatttttttatatgttaagaaaaacaagtattgaatataa |
46207574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 29 - 146
Target Start/End: Complemental strand, 29836786 - 29836667
Alignment:
| Q |
29 |
ggttgccaatgacggcgacagtgatgacggagatgagatggatgtagataacagtgcttctaagttttctaaaggttggatatgattggcacagatacta |
128 |
Q |
| |
|
||||| |||||| | ||||||||| | | ||||||||||||||| ||||||| ||||||||||| |||||||| ||||||||||| || |||| || |
|
|
| T |
29836786 |
ggttgacaatgatgtcgacagtgacaatgaagatgagatggatgtcgataacaacacttctaagtttactaaaggtaggatatgattgccatagatgata |
29836687 |
T |
 |
| Q |
129 |
--tatcttattataagttca |
146 |
Q |
| |
|
| |||||||||||||||| |
|
|
| T |
29836686 |
cctctcttattataagttca |
29836667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University