View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14329_high_8 (Length: 261)
Name: NF14329_high_8
Description: NF14329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14329_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 22 - 255
Target Start/End: Original strand, 42480473 - 42480707
Alignment:
| Q |
22 |
aaatagcatgatcttgaaatgttagataaagaacaatgccaattgaagtttgaagaatacaatcttgattcttcataatt-gatctaagtttggcacatc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42480473 |
aaatagcatgatcttgaaatgttagataaagaacaatgccaattgaagtttgaagaatacaatcttgattcttcataatttgatctaagtttggcacatc |
42480572 |
T |
|
| Q |
121 |
aatagcattgtcattatgcccatcttgattctccttctcaaactcatcacatgcaactctacgaaccttggaaagttgcttctcattttcttcaatttgt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42480573 |
aatagcattgtcattatgcccatcttgattctccttctcaaactcatcacatgcaactctacgaaccttggaaagttgcttctcattttcttcaatttgt |
42480672 |
T |
|
| Q |
221 |
ggtttttcgggttcagaggtggaatctatattctc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42480673 |
ggtttttcgggttcagaggtggaatctatattctc |
42480707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 215
Target Start/End: Original strand, 42473322 - 42473376
Alignment:
| Q |
161 |
aactcatcacatgcaactctacgaaccttggaaagttgcttctcattttcttcaa |
215 |
Q |
| |
|
|||||| || ||||||||||| ||||||||||| |||| || ||||||||||||| |
|
|
| T |
42473322 |
aactcaccatatgcaactctaggaaccttggaaggttgtttttcattttcttcaa |
42473376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University