View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14329_low_9 (Length: 250)
Name: NF14329_low_9
Description: NF14329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14329_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 16687927 - 16688163
Alignment:
| Q |
1 |
aaatcgcttacacataagtggaagaattggggtttgaaatataatcacgtcgttcgatttaatgattttgacatttttaccgattaagctatgacttatg |
100 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||| | ||||||| |||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
16687927 |
aaatcgcttacacatgagtggaagaatcaaaatttgaagtctaatcacatcgttcgatttaatgattttaacatttttactgattaagctatgacttatg |
16688026 |
T |
 |
| Q |
101 |
gacagtctaattatttaaaaataaaatcttagtttattcaccgttctaatcacattttctattacattttgatggcttcataaattctgaatgctataat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16688027 |
gacagtctaattatttaaaaataaaatcttagtttattcaccgttctaatcacattttctattacattttcatggcttcataaattctgaatgctataat |
16688126 |
T |
 |
| Q |
201 |
ttgttctttggaagttcccaaaaccttctaactcttc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16688127 |
ttgttctttggaagttcccaaaaccttctaactcttc |
16688163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University