View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1432_high_11 (Length: 234)
Name: NF1432_high_11
Description: NF1432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1432_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 5 - 217
Target Start/End: Original strand, 12581413 - 12581628
Alignment:
| Q |
5 |
atctaataacttagattgcaccaagattttgtttttgagagaatagaatgcaccgagataaaatggtgataaaaatacatttacatgatatataataatg |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12581413 |
atctaataacttagattgcaccaagattttgtttttgagagaatagaatgcaccgagataaaatggtgataaaaatacattaacatgatatataataatg |
12581512 |
T |
 |
| Q |
105 |
caaagtaaaataggatttcgactctgttcattttccagctgcatgggatccacatccatgtggtgttttcttttaattttatactacccgctta---att |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12581513 |
caaagtaaaataggatttcgactctgttcattttccagctgcatgggatccacatacatgtggtgttttcttttaattttatactacccgcttaattatt |
12581612 |
T |
 |
| Q |
202 |
atcaattcacaccact |
217 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
12581613 |
atcaattcacaccact |
12581628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University