View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1432_high_3 (Length: 398)
Name: NF1432_high_3
Description: NF1432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1432_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 18 - 349
Target Start/End: Original strand, 44693105 - 44693437
Alignment:
| Q |
18 |
gaaggaagtgttggaaatcattgag-aggttaaagttttatcgtggaggtggtgcctatcccgccttaatataccggcctgcctttattatgagtgaagt |
116 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44693105 |
gaaggaagtgttggaaatcgttgaggaggttaaagttttatcgtggaggtggtgcctatccagccttaagataccggcctgcctttattatgagtgaagt |
44693204 |
T |
|
| Q |
117 |
tggaatccgaagttgtgtctattgagatagttgtttttgtgctgtttggtttgtctgctgaaggtatcgttttctgtctggttttccttcgctggttgtc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44693205 |
tggaatccgaagttgtgtctattgagatagttgtttttgtgctgtttggtttgtctgctgaaggtatcgttttctgtctggttttccttcgctagttgtc |
44693304 |
T |
|
| Q |
217 |
tggttttcggggttgattccgtctcagtggtgctggatgttctgtgctggtttttgcctcctgttatgttgcagtttggctggtggctgctgtcagtttt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44693305 |
tggttttcggggttgattccgtctcagtggtgctggatgttctgtgctggtttttgcctcctgttatgttgcagtttggctggtggctgctgtcagtttt |
44693404 |
T |
|
| Q |
317 |
tgggctggtgtgttctgtgcagttagcagctgt |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
44693405 |
tgggctggtgtgttctgtgcagttagcagctgt |
44693437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University