View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1432_high_6 (Length: 318)
Name: NF1432_high_6
Description: NF1432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1432_high_6 |
 |  |
|
| [»] scaffold0536 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0536 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: scaffold0536
Description:
Target: scaffold0536; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 14 - 278
Target Start/End: Complemental strand, 5351 - 5088
Alignment:
| Q |
14 |
atactttaataaaaatgtgtgtcttat-tgtatattgctgtatattaatggacatatatgcctcaagaaaaagtaaaagaaaacgaaagatactagatct |
112 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5351 |
atactttaataaaaatgtgt--cttatctgtatattgctgtatattaatggacatatatgcctcaagaaaaagtaaaagaaaacgaaagatactagatct |
5254 |
T |
 |
| Q |
113 |
gcctgcctcatttttgttcttgaaaaacggctgatttnnnnnnnnnnnnnnnnnnncacaacactctctctattagaattatcctcaataatgctctgct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5253 |
gcctgcctcatttttgttcttgaaaaacggctgatttaaaattaaacaaataaaatcacaacactctctctattagaattatcctcaataatgctctgcc |
5154 |
T |
 |
| Q |
213 |
tcatgccactttgcaagcctgggaaaaagagcccgaagaaatcaatttcactatgttttagtataa |
278 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
5153 |
tcatgccactttgcaagcctaggaagaagagaccgaaaaaatcaatttcactatgttttagtataa |
5088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University