View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1432_high_7 (Length: 259)
Name: NF1432_high_7
Description: NF1432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1432_high_7 |
 |  |
|
| [»] chr4 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 259
Target Start/End: Complemental strand, 23422318 - 23422075
Alignment:
| Q |
13 |
aaaatgatgcatgatgaggatattatgtcacctagtaatccttggcaagttaattgttatgcaattagtgctaaaactgcttctgagcataacacca--- |
109 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
23422318 |
aaaatgatgcatgatgaggatattgtgtcgcctagtaatccttggcaagttaattgttatgcagttagggctaaaactgcttctgagcataacaccacca |
23422219 |
T |
 |
| Q |
110 |
tataatgactgttttggaaagtatcaagtggtaggcccctgaaagtagttggatccattttaacactgatggcacatataaaggagggactaggagtctt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23422218 |
tataatgactgttttggaaagtatcaagtgttaggcccctgaaagtagttggatccattttaacactgatggcacatataaaggag------ggagtctt |
23422125 |
T |
 |
| Q |
210 |
gctggatgcagaggagtgtcacgtgggaagaatggcaaatggatctgtat |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23422124 |
gctggatgcagaggagtgtcacgtgggaagaatggcaaatggatctgtat |
23422075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 23876774 - 23876854
Alignment:
| Q |
47 |
gtaatccttggcaagttaattgttatgcaattagtgctaaaactgcttctgagcataacaccatataatgactgttttggaaa |
129 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||||||||| ||||| || ||||||||||||||||| |
|
|
| T |
23876774 |
gtaatccttggcgtgttaattgttatgtggttagtgctaaaactgcttctgagcagaacac--tacaatgactgttttggaaa |
23876854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 58
Target Start/End: Original strand, 23883142 - 23883182
Alignment:
| Q |
18 |
gatgcatgatgaggatattatgtcacctagtaatccttggc |
58 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
23883142 |
gatgcatgatgaggattttgtgtcacctagtaatccttggc |
23883182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 56
Target Start/End: Complemental strand, 23420156 - 23420118
Alignment:
| Q |
18 |
gatgcatgatgaggatattatgtcacctagtaatccttg |
56 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
23420156 |
gatgcatgatgaggattttgtgtcacctagtaatccttg |
23420118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University