View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1432_low_12 (Length: 258)
Name: NF1432_low_12
Description: NF1432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1432_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 14602487 - 14602739
Alignment:
| Q |
1 |
ttcccctctttcacaatttgtttagatgagcttttcagatcgcagcacaccatcgtttccggccaaacctccttcatcgcaaccacaaccacatttcagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14602487 |
ttcccctctttcacaatttgtttagatgagcttttcagatcgcagcacaccatcgtttccggccaaacctccttcatcgcaaccacaaccacatttcagc |
14602586 |
T |
 |
| Q |
101 |
gtgaatctttttgtgttttaatgtgcaaataataatatctacagcattgtgaacaaattatgtttggtaaggaacaaaatacaaccaataaaaaacacag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14602587 |
gtgaatctttttgtgttttaatgtgcaaataataatatctacagcattgtgaacaaattatgtttggtaaggaacaaaatacaaccaataaaaaacacag |
14602686 |
T |
 |
| Q |
201 |
caaggaagatggttctcaccaaggtcgttaccgacggcgctgttcatctcact |
253 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14602687 |
caaggaagatgattctcaccaaggtcgttaccgacggcgctgttcttctcact |
14602739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University